15-10-2015
Mathematics

contestada

round 5.36201 to one decimal place

Respuesta :

playerawesome1 playerawesome1

15-10-2015

5.36201 rounded to one decimal place is 5.4

Answer Link

Otras preguntas

shoe store has a sale of 5% off each pair. you

What is the best way to check the buoyancy of your pfd?

The safest way for someone to make an online purchase is to

4w^3−8w+12 factor the polynomial 5t^2+20t+50 factor the polynomial

The weight of a synthetic ball varies directly with the cube of its radius. a ball with a radius of 2 inches weighs 5.605.60 pounds. find the weight of a ball o

Find the constant of proportionality, or ratio, of y to x in the triangle below

When Congress challenged Oklahoma’s attempt to move its state capital, the Supreme Court sided with the state. Why? Congress has less power than the Supreme Cou

There are 5 red marbles, 8 blue marbles, and 12 green marbles in a bag. What is the theoretical probability of randomly drawing a red marble?

A pyramid has all sides that are equilateral triangles. Each triangle has side lengths of 9 centimeters. If the surface area of the pyramid is 140 4 square cent

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the