bran06 bran06
  • 03-11-2017
  • Mathematics
contestada

6 times the sum of y and 11

Respuesta :

joonlee03
joonlee03 joonlee03
  • 03-11-2017
6(y+11)=
6y+66
if you tell us what y is I can answer the whole thing

Answer Link
itsdianaduh itsdianaduh
  • 03-11-2017
It would be 11+1 = 12•6=96 that’s what I believe
Answer Link

Otras preguntas

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated
II. Una con una linea el tipo de tejido con su función. Fundamentales Floema Primarios- apicales Meristemáticos Esclerénquima Dérmicos Epidermis Conductores Sir
name the image point when the object point (4,4) is mapped by the following translations. (x,y)-->(x-4,y+2)
Sales in a company are growing annually at the rate of 10%. If the sales in the year 2020 were 1000 units, what will be the sales in year 2022? 1210 1200 1150 1
You are running a fuel economy study. One of the cars you find is blue. It can travel 33 1/2 miles on 1 1/4 gallons of gasoline. Another car is red. It can tra
what are 2 problems that could occur with the skeletal system​
Simplify 5r + 4p - 8r + 6
6. A football player runs at 9 m/s and plows into a 70 kg referee standing on the field causing the referee to fly forward at 4.0 m/s. If this were a perfectly
The picture below is an example of a
For a ride on a rental scooter, All paid a $7 fee to start the scooter plus 7 cents per minute of the ride. The total bill for All's ride was $20.58. For how ma