okayokayokay4271 okayokayokay4271

14-06-2017
Business

contestada

Marcy was playing under the kitchen table when she stood up suddenly and bumped her head. she pointed at the table and sternly said, naughty table! this is an example of _____.

Respuesta :

andriansp andriansp

21-06-2017

The answer to the question above is "animism" which is the term for the situation explained on the question above. Animism is a term that explains a situation where a person describes an unliving object as a living creature. In the passage above, Marcy was treating the table as a living creature, thus, "animism" is the best answer for the question above.

Answer Link

Otras preguntas

On the top of page 90, Willy is offended by Charley and challenges him, “Put up your hands!” Willy and his boys frequently show a tendency towards violence when

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

What two scientists are responsible for saying plants and animals are made of cells leading to the development of the Cell Theory? Group of answer choices Schle

Help this is too confusing

What are situations that could put family safety at risk?

Which common communication is MOST likely to be considered folklore?

Express your view on the topic " Word is Stronger than Sword "

A student rolled 2 dice. What is the probability that the first die landed on a number less than 3 and the second die landed on a number greater than 3?

What is the effect of multiplying the following numbers? OA. The solution is equal to 1115 OB. The solution is less than 11. OC. The solution is less than OD. T

calcula la suma de los quince primeros multiplos de 9