schoolking schoolking

16-01-2022
Mathematics

contestada

Solve the system by graphing:
y = x^3 - 4x^2 + x + 3
y = 2x - 1

Respuesta :

hochunyung94 hochunyung94

16-01-2022

Answer:

(-1, -3) and (1, 1)

Step-by-step explanation:

Use a graphing calculator to graph out both lines:

(See picture)

Both lines intersect at points (-1, -3) and (1, 1). These are the solutions for the system of equations.

Ver imagen hochunyung94

Answer Link

Otras preguntas

what should a healthcare worker do with bed sheets that are soaked with blood?

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

20 ml of D.W added to 60 ml of 2% w/v of phenobarbital solution , find the final concentration

Find the distance between (3, 8) and (0, 5). Round your answer to the nearest hundredth.

Why is Hawaii volcanoes National Park a popular place to visit? What can you see and do there?

Which form of the compensation would be the greatest? a) A salary of 3,000.00 Monthly b) wages of 20.00 per hr. Receiving Commission of 20%.

Evaluate. (1/6^2)Enter your answer as a fraction in simplest form.

The narrator of I Know Why the Caged Bird Sings introduces Mrs. Flowers by calling her the lady who threw me my first lifeline." A lifeline is a rope that helps

Rationalise the denominator of: (√3 - √2)/(√3+√2) = ?

Need the answer will mark as brainliest