doodlebug8284 doodlebug8284
  • 02-12-2021
  • Law
contestada

What is a short order cook vs line cook.

Respuesta :

sicklydiaa
sicklydiaa sicklydiaa
  • 02-12-2021

 Short order cooks cook quick meals at a restaurant and prepare many meals simultaneously. Unlike line cooks, they are assigned to specific stations where they complete one part of a meal at a time.  

Answer Link

Otras preguntas

John Wycliffe and John Hus are important figures of the Protestant Reformation because __________. a. they used force to stop the spread of Protestantism
Why did many Chinese find communism appealing in its early stages?
Why did the War Hawks push for the invasion of British-held Canada?
Circle 1: center (8, 5) and radius 6 Circle 2: center (−2, 1) and radius 2 What transformations can be applied to Circle 1 to prove that the circles are similar
Jack is working with layer masks on an image, but he is worried that he may damage the image. Which of these would be an accurate fact about layer masks? The la
Evaluate |c2 + b2|, given a = 5, b = -3, and c = -2. A.) 2 B.) 6 C.) 10 D.) 13
This image is MOST likely to be associated with which Ancient Eastern religion? A) Hinduism B) Buddhism C) Christianity D) Confucianism
1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
A machine that is used to print newspapers is a what?
In the gills of fish, _______ is absorbed into the blood vessels and carbon dioxide is released from the blood vessels.