annalisekemp annalisekemp

15-01-2021
Mathematics

contestada

What expressions are equivalent to -4/3 p -2/5

Respuesta :

tommyoutit tommyoutit

15-01-2021

Answer:

-3/6

Step-by-step explanation:

integer rules

Answer Link

Otras preguntas

A researcher is studying the effects of the college experience on attitudes, values, and behavior and is comparing small random samples from each class at the s

Replicate the following gene strand, and then transcribe the template strand:GTTAATGGCCATGATGGCTTTGTGATTAAGC .Translate the mRNA from above using single letter

Simplify: 8 cos 30° tan 60° + 2 sin'65° + 2 cos 65°

When solving an equation, francesca's first step is shown below. which property justifies francesca's first step? Original equation :4 + (1+x) = 3First step :(4

The classical dichotomy is the separation of real and nominal variables. The following questions test your understanding of this distinction. Valerie spends all

What are the formulas for designing Archimedes wind turbine blades dimensions, blade angles, distance between blades, and efficiency? what are the nomenclature

Ellen : Hi, Dave, it's Ellen. Where are you? Dave : Oh, hi, Ellen. I (1) ___ (watch) the bask match. The Wild Elephants (2)___ (pla the Golden Monkeys. The Elep

The equilibrium in the reaction H₂(g)+Cl₂(g)⇌2HCl(g) 194kj will shift in which direction if the pressure of the reaction system increases

In his radical pamphlet Common Sense, what did Thomas Paine encourage Americans to do? a) Declare independence from Great Britain. b) Form an alliance with Fran

The conception of a dialectical progress of history, wherein competing struggles between social classes lead to a balancing and unbalancing of power until event