isabellelopes454647 isabellelopes454647

15-09-2020
Mathematics

contestada

If it took you 7 hours to mow 4 lawns, then at this rate, how many lawns could be mowed in 35 hours?

Respuesta :

Seagull01 Seagull01

15-09-2020

Answer:

20

Step-by-step explanation:

If it takes you 7 hours to mow 4 lawns

Then 35/7=5

So you multiply 5*4= 20.

Therefore, you can mow 20 lawns in 35 hours.

Answer Link

jessica1886 jessica1886

15-09-2020

Hope this helps............

Ver imagen jessica1886

Answer Link

Otras preguntas

Which of the following were weaknesses apparent in American society in the late 1800s? A. People became too materialistic. B. Industry used the nation's resou

Es el mes de agosto. Nieva y hace mucho frío. Hoy voy a esquiar con mis amigos. Estoy en _______. (1 point) Question 30 options: 1) la Argentina 2) Cuba 3) C

Zina spends 1.5 hours setting up her sewing machine and making one hat. The total amount of time spent making hats can be represented by the sequence below.1.5,

The ________ phase is when most cell growth will occur, DNA is unreplicated. The ________ phas occurs between chromosome replication and cell division. During _

And animals weight change from 12 pounds to 16 pounds what was the percent increase to the nearest whole number

The assassination of archduke ferdinand was one of the major causes of a. the crimean war. b. world war i. c. world war ii. d. the suez war.

Adenosine triphosphate, or ATP, is primarily used as _______ in living organisms.

Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3

. If a father's genotype is Tt and a mother's is Tt, what are the odds that the children will have a genotype of TT? 50 percent 75 percent 25 percent 100 percen

Endoplasmic Reticulum?