Iwritewithpencils Iwritewithpencils

14-05-2020
Biology

contestada

How do I use a codon wheel to solve this sequence of DNA?

AGTACCCGTTAATTAGTTGCCG

Respuesta :

andyk38105 andyk38105

14-05-2020

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

Answer Link

Otras preguntas

Exhaled breath from your mouth can condense when:

The colonists protested the stamp act by

The domain is an email message tell you the

If a business decreases the price of its product and the product is elastic what happens to the total revenue of the business

Without oxygen, a cell can obtain ____________ atp molecules.

Which sentence uses who correctly? From who did you receive the call? Who did you call? Who is the person that I should call? To who are you speaking?

The table below shows the surface area y, in square inches, of a shrinking puddle in x hours: Time (x) (hours) 1 4 7 10 Surface area (y) (square inches) 100 8

Genetic engineering occurs when scientists make an exact copy of an organism scientists remove genes from a cell to study them scientists turn genes on and o

Two stars, star 1 and star 2 are at almost equal distances from earth Star 1- 3.61 mass of star Star 2- 3.59 mass of star Which stamens is correct A-Earth exe

A baseball team has won 13 out of 18 games they played this session. How many additional games must the team win in a row to raise its winning percentage to 80%