kaylabutler2333444 kaylabutler2333444

14-03-2019
Mathematics

contestada

Find the area. Please help thanks so much

Find the area Please help thanks so much class=

Respuesta :

leslieroman1017 leslieroman1017

14-03-2019

I’m pretty sure it’s 165 sq ft

Answer Link

Аноним Аноним

14-03-2019

Answer:

its 165

Step-by-step explanation:

15x11=165

you forget the 9 because its not the height of the whole thing

hope it helps :)

Answer Link

Otras preguntas

1) Jeremy can jog 1 (1/3) miles in 1/4 hour. What is his speed in miles per hour?

list and explain at least one of the scientific advance of the cold wasr era be sure to include the impact on societies?

Family. This is a theme. This is a central idea. This is a topic None of the above.

A beverage is by mixing 1 part of water with 3 parts of fruit juice. How many parts of water are mixed with 1 part of fruit juice? (A) 1/3 (B) 1/2 (C) 3/2 (

Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t

if n^3=x and n^4=20x , where n>0, what is the value of x?

1) Suppose Emily randomly turns on 2 of the 7 computers. Which expression could you use to determine the probability that both computers will be infected with a

LCD 7/8 and 1/4 Im stuck help pls

Run 4 1/2 kilometers in 1/3 of an hour how many kilometers can she run in 1 hour

5. If the number of employees is represented by x, which function represents theamount each received?a. f(x) = 65000xb. f(x) = x + 65000c. f(x)d. f(x) = x - 650