kariannefan5798 kariannefan5798

13-05-2023
Physics

contestada

74as is a beta-plus emitter used for locating tumors with pet. part a what is the daughter nucleus? what is the daughter nucleus? a. 7432ge b. 7333as c. 7533as d. 7434se

Respuesta :

Otras preguntas

Olivia is an athlete. During training this morning, she ran three laps. It took her 5/6 minute to finish the first lap. The second lap took her 1/12 more minu

Why do Texas musicians move to Texas to be part of its music scene

What is the order from least to greatest of the following: 0.6, −0.3, 3.3, and −3.5? 3.3, 0.6, −0.3, −3.5 0.6, −0.3, −3.5, 3.3 −0.3, 3.3, 0.6, −3.5 −3.5, −0

20 points to whoever answers this asap <3 Joe and Andrew shot baskets in a school fair. Joe made 9 baskets, which is 2 baskets more than Andrew. Supply the c

Which statement is true about the functions f(x)=-15x^2+32 and g(x)=-17x^2+5x+32? a. f(x) and g(x) have the same zeros. b. f(x) has a higher maximum than g(x).

Which inequality represents this number line? x > -1 x < -1 x ≥ -1 x ≤ -1

which graph represent 5x-2y=3

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated

what were the CAUSES and CONSEQUENCES of the decline of mughal empire(please give a good answer long with causes and consequences)

The ratio of the same side interior angles of two parallel lines is 1:14. find the measures of all eight angles formed by the parallel lines and transversals.